Stomaco Salute > ricerche > Esame di equini lesioni gastriche ghiandolari per i batteri, tra cui Helicobacter spp con la fluorescenza in situ hybridisation

Esame di equini lesioni gastriche ghiandolari per i batteri, tra cui Helicobacter spp con la fluorescenza in situ hybridisation

Esame di equini lesioni gastriche ghiandolari per i batteri, tra cui Helicobacter spp
da fluorescenza in situ ibridazione

Abstract
sfondo
Lo stomaco ghiandolare equina è comunemente influenzata da erosione e ulcere. Lo scopo di questo studio era di valutare se i batteri, tra cui l'Helicobacter, potrebbero essere coinvolti nell'eziologia delle lesioni ghiandolari gastriche visto nei cavalli.
Risultati
lesioni allo stomaco, così come normali mucosa che appaiono sono stati ottenuti da cavalli macellati per consumo umano. Tutti i campioni sono stati testati per l'attività ureasica utilizzando il Pyloritek ® test, mentre il contenuto batterica della mucosa è stata valutata utilizzando Fluorescence In Situ
ibridazione. Nei campioni sub selezionati, la caratterizzazione dei batteri è stato perseguito ulteriormente la clonazione e il sequenziamento. lesioni della mucosa sono stati trovati in 36/63 stomaco e inclusi pliche iperplastici, strutture polipoidi ed erosioni focali. Nessuno dei campioni sono stati testati positivi per l'attività ureasica o per pescare con la sonda specifica genere Helicobacter. Nei campioni di lesioni, così come campioni normali, cloni con il 99% delle somiglianze con Lactobacillus salivarius
e Sarcina ventriculi
sono stati trovati. Escherichia
come cloni batterio e cloni Enterococcus sono state dimostrate in uno erosione focale. Sulla base di un albero filogenetico questi cloni avevano 100% di somiglianza di Escherichia fergusonii e Enterococcus faecium
. L'Enterococcus sono stati trovati colonizzare la superficie della mucosa, mentre E. fergusonii
organismi sono stati dimostrati anche intraepiteliale.
Conclusione
gastrico Helicobacter spp. Non è stato possibile verificare come essere coinvolti nelle lesioni dello stomaco ghiandolare del cavallo. Dal E.
fergusonii è stato descritto come un patogeno emergente in entrambi gli esseri umani e gli animali, il ritrovamento di questo batterio in warrant erosione gastrici ulteriori chiarimenti sul fatto che l'infezione gastrica con questo tipo batterio è importante per i cavalli.
Sfondo
nei cavalli, lesioni della parte non ghiandolare dello stomaco sono altamente prevalenti e sembrano essere causati da esposizione acida eccessivi [1], ma poco è stato descritto per quanto riguarda le lesioni nella parte ghiandolare. Le lesioni localizzate nella regione ghiandolare sono stati dimostrati in 58% di 162 cavalli ospedalizzati [2], in 47% di 345 cavalli da corsa [3] e mentre la causa di questi non hanno ricevuto molta attenzione, esposizione all'acido non sembra essere il fattore primario , come è stata trovata alcuna correlazione tra le lesioni delle due regioni dello stomaco [3].
batteri gastrici come la causa per lesioni allo stomaco ghiandolari sono stati suggeriti per molte specie animali e negli esseri umani questi costituiscono un importante fattore di rischio accertato. Degli organismi gastrici trovati, Helicobacter pylori
è stato descritto il più a causa della sua potenziale patogeno di indurre gastrite cronica, ulcere, adenocarcinomi e mucose tessuto linfoide associato (MALT) linfoma negli esseri umani [4-6]. I batteri di questo genere sono stati trovati anche in campioni di tessuto gastrico da animali tra cui cani, maiali, pecore e bovini [7-10].
Nel cavallo, prove contraddittorie esce sul fatto che i batteri che possono causare specificamente si verificano lesioni gastriche. Alcuni studi hanno indicato che l'Helicobacter gastrica spp
. sono presenti mucosa normale che appare utilizzando PCR e immunochimica [11, 12], mentre altri hanno trovato alcuna prova di un collegamento tra la presenza di lesioni e batteri [13]. Come specie batteriche gastrici sono stati confermati o suggerito come parte della patogenesi di alcuni tipi di patologia gastrica negli esseri umani e altre specie animali, lo scopo di questo studio era di valutare se i batteri potrebbero essere coinvolti nella patologia osservata nel equina stomaco ghiandolare. Un focus principale è stato quello di fornire ulteriori prove per quanto riguarda la presenza e la localizzazione dei batteri in generale a livello della mucosa del equina stomaco ghiandolare. Particolare attenzione è stata messa su come ottenere informazioni riguardanti la presenza e il coinvolgimento di tutte le specie di Helicobacter
nelle lesioni della mucosa. La fluorescenza In situ
tecnica di ibridazione (FISH) è stato utilizzato per questo scopo, che permette l'utilizzo di sonde rRNA mirati sia per la popolazione batterica totale e definite Genere /specie. Questo approccio permette di determinare la morfologia batterica, l'abbondanza, la posizione nei tessuti, e anche indicazioni sui tassi di crescita e di attività fisiologiche [14].
Risultati
lesioni ghiandolari lordi sono stati osservati in 36 dei 63 stomaci esaminati (57,1 %). La maggior parte delle lesioni sono stati osservati nella regione antro (91,7%). In sei stomaci, le lesioni sono state ulteriormente o esclusivamente visti nella regione cardias o corpus. Non sono state trovate lesioni nel duodeno
Le lesioni sono state classificate in tre gruppi:. Poliposa (2 stomaci con masse polipoidi situati sia nel cardias e l'antro con dimensioni tra 1 e 5 centimetri di diametro), ii: pliche iperplastici lesioni (13 stomaci) o III:. iperemico, erosivi o ulcerative lesioni, che sono stati visti in 21 stomaci Aziende il rugae iperplastici sono stati tutti visti nella antro e variava da avere iperemia intenso con essudato di rugae con aspetto normale superficie della mucosa. ispessimento lordo della pliche antro è stato causato principalmente da iperplasia della foveolae gastrica rispetto ai rispettivi campioni normali. Le lesioni rimanenti sono stati tutti trovati ad essere piccole lesioni solitarie di non più di circa 1 × 2 cm. aree focali di gastrite erosiva era le scoperte più comuni di queste lesioni tipo e caratterizzati come desquamazione delle cellule superficiali dell'epitelio luminale con un essudato fibrinopurulent concorrente, detriti cellulari luminale e un infiltrato di cellule mononucleate prevalentemente della lamina propria. erosioni più profondi disponibili a 9 stomaci eroso sia la regione delle fossette gastriche e parti delle ghiandole, che è stata osservata con gastrite solo dei tessuti immediati. Un vero ulcera stato trovato che estende l'intero spessore della lamina propria, esponendo la muscolaris lamina al lume. sono stati trovati un massimo di due lesioni in ciascuna di queste stomaci.
Helicobacter e attività ureasica prova
Utilizzando la sonda specifica genere Helicobacter assenza di segnali positivi sono stati trovati in uno qualsiasi dei 79 campioni di tessuto (36 campioni accoppiati e 7 controlli) . In accordo con questi risultati del pesce, nessuno dei campioni sono risultati positivi per l'attività di ureasi sia. I controlli interni di tutti i test dell'ureasi trovato positivo come indicazione di un kit di test funzionale.
batteri in generale
In generale, solo stati osservati correlata pochi batteri alla superficie della mucosa sia nella feriti nonché nello stomaco sano campioni. Nel complesso, quattro morfologici diversi tipi di cellule batteriche possono essere visualizzati con la sonda Eubatteri: 1) di piccole dimensioni, brevi (0.2-0.5 micron) aste coccoidi, 2) aste distinte (1 × 3 micron), 3) aste a lunga catena (fino a 60 micron) o 4) di grandi dimensioni (2-3 micron di diametro) batteri coccoidi chiaramente che divide in coppie. In genere, quando presenti, i batteri sono stati osservati in gruppi associati con le particelle di alimentazione o situati vicino alla superficie della mucosa
La prova di gastrite batterica è stato trovato in una lesione allo stomaco grossolanamente caratterizzato come una erosione solitaria, 1 × 2 cm di dimensioni, essendo al centro iperemica e circondata da un bordo epiteliale proliferativa (Fig. 1). Microscopicamente, erosione focale della mucosa con stillicidio di eritrociti e leucociti, soprattutto neutrofili di origine, è stato visto. Gli essudati sono stati inoltre osservati nei box gastriche. Una reazione infiammatoria cellulare con cellule mononucleate è stato visto che si estende in profondità quanto in muscolare lamina. La superficie della mucosa infiammata e le fossette gastriche sono stati trovati fortemente colonizzato dai coccoidi a barre corte applicando la sonda per i batteri generali (Fig. 2). Le brevi barre erano particolarmente osservate infiltrante l'erosione. Sono stati osservati anche intracellulare in cellule epiteliali, nonché all'interno granulociti neutrofili. La colonizzazione batterica dello stomaco è stato limitato alla lesione in quanto non sono stati osservati i batteri nel campione mucosa sana corrispondente. Figura 1 focale lesione erosiva (freccia bianca) dimostrando gastrite batterica a valutazione istologica. Lesione è stato di circa 2 × 2 cm e situato nel antro vicino all'ingresso del piloro.
Figura 2 mucosa gastrica con gastrite erosiva associata con i batteri. La superficie mucosale e detriti cellulari adiacenti è fortemente colonizzato da batteri (rosso). Alcuni batteri sono visti intracellulare nell'epitelio intatta (freccia) e nelle cellule epiteliali degenerate e necrotiche (freccia). Inoltre, i batteri si trovano all'interno di granulociti. Fluorescente in situ ibridazione con la sonda mira batteri, il filtro impostato 43, bar = 25 micron
.
Clonazione e il sequenziamento Sulla base della morfologia e intensità dei batteri dimostrato a base di pesce, sottocampioni dei /c campioni C sono stati selezionati per clonazione e sequenziamento di rappresentare campioni compresa quella con gastrite batterica. Illustrazione di sottocampioni preferito stomaci dimostrano vari batteri morfologie, due differenti tipi di cloni sono stati trovati in campioni normali mucosa appaiono (c campioni), un clone ha il 99% di somiglianza a Lactobacillus salivarius
JCM 1231 (AB370881) e l'altro tipo di cloni avuto 99% di somiglianza a Sarcina ventriculi
DSM 316 (X76650).
dalle lesioni (campioni C), cloni sono stati trovati anche con 99 % di somiglianza a Lactobacillus salivarius
JCM 1231 (AF182725). Dalla mucosa con gastrite batterica, quattro su dieci cloni abbinati al 100% Enterococcus faecium
, mentre i restanti sei cloni (sequenza ottenuta depositato presso GenBank con l'adesione n. GQ423062) apparteneva ad una di Escherichia come
batterio. Un albero filogenetico è stato costruito con i sei Escherichia
come cloni dalla lesione e tutti avevano 100% di somiglianza per il tipo di ceppi di E. sia
fergusonii e Shigella flexneri
(fig 3). Applicando una sonda specifica proteobacteria gamma delle barre corte infiltranti l'epitelio, nonché trovato intracellulari all'interno granulociti neutrofili, sono stati verificati l'Escherichia
come batterio mentre Enterococcus faecium
organismi sono stati identificati colonizzare la superficie epiteliale dalla sonda specifica Enterococcus (Fig 4 e 5). Figura 3 Un albero filogenetico di rRNA 16S sequenza genica somiglianza, che mostra la posizione dei sei cloni appartenenti a Gammaproteobacteria trovato nel cavallo 50L e più strettamente legati ceppi di tipo appartenenti al genere Escherichia. I sei cloni (acc.no. GQ423062) hanno 100% di somiglianza a Shigella flexneri
ed E.
fergusonii. Enterobacter sakazakii (AB004746) è stato utilizzato come outgroup. numeri di accesso Sequenza vengono presentati.
figura 4 mucosa gastrica di cavallo 50L con gastrite erosiva associata con i batteri. Applicazione di una sonda marcata con fluoresceina per Gammaproteobacteria e una sonda marcata Cy3 per Enterococcus, un E. coli
come organismo (verde) (freccia) è stato trovato intracellulare all'interno delle cellule epiteliali e sulla superficie epiteliale che E. faecium (rosso) ( ' stella bianca '(colonizzata solo la superficie epiteliale. filtro impostato 43/38, bar = 10 micron.
Figura 5 mucosa gastrica di 50L cavallo con gastrite erosiva associata con i batteri. alto ingrandimento dimostrando E. coli
come aste ( verde) all'interno delle cellule epiteliali estrusi. fluorescente in situ ibridazione con la sonda mira Gammaproteobacteria, filtro impostato 38, bar = 10 micron
. Discussione
studi precedenti che coinvolge lo stomaco equina sono per esempio utilizzati PCR mira il gene 16S rRNA di particolare Helicobacter
spp. [12]. gli svantaggi che usano la PCR sono che la quantità e la posizione dei batteri non è noto e non è certo che i batteri sono vivi o anche se il DNA è nudo. Pertanto, è stato deciso che utilizzando la tecnica FISH fornirebbe una migliore e più informazioni dei batteri presenti nello stomaco ghiandolare del cavallo, poiché questi aspetti sono superati con questa tecnica. Questa tecnica è stata utilizzata in precedenza per descrivere la distribuzione spaziale di Helicobacter
spp. nel tratto gastrointestinale dei cani e nello stomaco di cavalli sani per dimostrare la microbiota della mucosa normale che appare squamose e ghiandolare [15, 16]. Per quanto a nostra conoscenza questo è il primo studio a base di pesce per esaminare le lesioni dello stomaco ghiandolare.
Nel presente studio un caso di gastrite associata a colonizzazione batterica è stato rivelato. Specialmente la distribuzione di batteri suggerito un collegamento con la patologia osservata. La quantità di batteri era marcatamente aumentata attorno alla lesione e sono stati strettamente aderire alle cellule epiteliali, con i batteri si estendono nelle cripte e intracellulare trova. La clonazione ha dimostrato che si trattava di una doppia infezione con Enterococcus faecium
e di un Escherichia
come batterio, ma è stato successivamente verificato utilizzando l'ibridazione in situ
con proteobatteri gamma sonda che era solo l'Escherichia
come batterio che infiltrato le ulcerazioni superficiali e sono stati trovati intracellulare nelle cellule epiteliali e nei granulociti neutrofili. infezione enterobatteri nell'intestino è un fenomeno comune, ma è raro trovare queste infezioni nello stomaco e non è mai stata riportata in prima cavalli adulti. Questo risultato è molto interessante, ma ulteriori studi hanno bisogno di chiarire come comune questo fenomeno è in cavalli. Inoltre, se questo tipo di infezione è di origine primaria o secondaria avrebbe bisogno di ulteriori chiarimenti. L'Escherichia
come cloni tutti avevano il 100% 16S rRNA gene somiglianza sia E. fergusonii
e Shigella flexneri
. Così, in questo studio, non può essere precisato sperimentalmente quale di questi due organismi che erano presenti in questa lesione ghiandolare. Tuttavia, gli esseri umani sono stati segnalati per essere l'unico ospite naturale per Shigella
[17], mentre E.
fergusonii è stata associata ad una vasta gamma di infezioni intestinali ed extra-intestinali in entrambi gli esseri umani e gli animali, tra cui cavalli [18 , 19]. E 'quindi molto probabile che l'Escherichia
come batterio trovato in questo studio appartiene a E.
fergusonii. Gli studi hanno riportato E. fergusonii
come un patogeno emergente e associati con particolare batteriemia e infezione della ferita, ma il suo ruolo preciso nelle infezioni in entrambi gli esseri umani e gli animali deve ancora essere chiarito [20]
. Microbiology nei campioni
l'ambiente nello stomaco ghiandolare è generalmente molto ostile verso microbi [21]. E 'ben noto che, a differenza di esseri umani e cani che sono alimentatori pasto, cavalli sono produttori di acido continue, probabilmente a causa di un modello di alimentazione continua [22, 23]. Il pH nella parte ventrale dello stomaco equina è stabile intorno al pH 1-3 per tutto il periodo di 24 ore [24], di conseguenza, la relativa bassa diversità dei batteri osservati in campioni di mucosa in questo studio non è stato inaspettato.
La caratteristica fenotipo morfologico di grande cocchi crescita in tetradi regolari è stato creato per essere un clone con una somiglianza 99% di Sarcina ventriculi
. Questo organismo è noto per essere in grado di crescere in contenuto dello stomaco e ha la struttura Tetrade caratteristica, se coltivate da pH 1- pH 3 [25]. In questo studio, la constatazione di questi organismi non può essere stabilita ad essere parte di qualsiasi patologia specifica, come sono stati trovati in numero ridotto nei campioni accoppiati (cioè lesione e normali), nonché nei campioni di controllo. batteri Sarcina simili sono stati trovati in una varietà di specie, dove sono stati supposti per causare abomasale gonfiare, emorragie e ulcere in agnelli e capretti capra [26, 27] e un possibile legame di dilatazione gastrica in entrambi i cani e cavalli ha anche stato suggerito [28]. Nessuna prova di accumuli di gas è stata osservata macroscopicamente in uno di questi cavalli e, quindi, non sembra che la presenza di Sarcina ventriculi
contribuito alla patologia osservata in questi cavalli.
Non sorprende che il Lactobacillus (Lactobacillus salivarius
) è stata trovata nei tessuti studiati ed è stato precedentemente riportato che diversi Lactobacillus
spp., compresi L. salivarius
, sono presenti nei cavalli sani [16, 29]. Le funzioni prossimali equina stomaco come deposito per mangimi, nonché un vano per la fermentazione intragastrica. L'ecosistema in questa regione consiste sia anaerobica e batteri lattato-utilizzando in gran numero, che sono responsabili per l'aumento di acidi grassi volatili sulla fermentazione di carboidrati [30]. Soprattutto lattobacilli sono stati trovati aderente all'epitelio nella parte prossimale dello stomaco equina [31] e questi batteri probabilmente passare allo stomaco ghiandolare come parte della normale turn-over. Abbiamo esaminato solo sottocampioni e taxa più batterica si troverà nella parte sana dello stomaco ghiandolare se uno studio più completo comunità microbiota è stato fatto.
Validità dei risultati di Helicobacter
Nessuno dei campioni di tessuto da l'antro regione ha dimostrato segnali positivi dal Helicobacter spp
. sondano in questo studio e non a spirale batteri sono stati osservati con la tecnica FISH sia. In un recente studio dal Venezuela, a forma di spirale batteri sono stati segnalati in biopsie dalla regione cardiaca dello stomaco equina macchiato con la macchia Warthin-stellata [12]. Helicobacter spp
. noti per essere in grado di colonizzare stomaco producono grandi quantità di ureasi citoplasmatica [32] Il test rapido dell'ureasi utilizzato nella presente inchiesta, Pyloritek ®, rileva l'attività dell'ureasi del campione di tessuto dalla produzione di ammoniaca quando urea è presente. E 'ampiamente utilizzato nella pratica umana per rilevare gastrite causata da Helicobacter spp
. I valori predittivi positivi e negativi erano tra il 98,1-100% e 95,8-100%, rispettivamente, in uno studio testando pazienti umani prima e dopo l'eradicazione del batterio [33]. In questo studio, nessun test positivi sono stati trovati, indicando che le biopsie in questo studio contenevano nessun batteri con la capacità di produrre ureasi.
Conclusioni
gastrico Helicobacter
spp. Non è stato trovato e non poteva essere legato alle lesioni allo stomaco dei 36 cavalli analizzati in questo studio. La patologia si trovano in questo studio ha incluso strutture polipoidi, rugae iperplastico e piccole erosioni, ma il coinvolgimento batterica è stato trovato solo in un caso di erosione. In questa lesione, un clone Escherichia simile, molto probabilmente E.
fergusonii, è stato trovato intracellulare. Se questa è stata una infezione primaria o secondaria non può essere concluso. quantità molto limitate di batteri in generale sono stati trovati nella zona ghiandolare equine come previsto. Quindi, il rilevamento di una moderata a elevate quantità di batteri a livello della mucosa ghiandolare, nonché nelle cripte dovrebbe essere motivo di preoccupazione poiché non sembra essere normale nella equina stomaco ghiandolare. Ulteriori studi che coinvolgono i batteri e la relazione con lesioni gastriche di cavalli con segni clinici confermati sono garantiti, come questi cavalli non sono stati inclusi in questo studio
. Metodi
Cavalli e studio di design
Lo studio è stato fatto come una studio trasversale di stomaco da una popolazione di 63 cavalli mattatoio di Danimarca. I cavalli sono stati approvati dal Veterinario Ufficiale sano da macello. I cavalli sono stati storditi con un proiettile captivo e dissanguato. Lo stomaco, di cui 5 - 10 cm dell'esofago distale e 10 cm del duodeno prossimale, è stato rimosso subito dopo l'eviscerazione e ha aperto lungo la grande curvatura. Ingesta sono stati rimossi e, se necessario, la mucosa è stata delicatamente risciacquato con un minimo di acqua di rubinetto prima ispezione. Solo lo stomaco con lesioni macroscopiche della mucosa ghiandolare sono stati inclusi, così come sette stomaco di controllo senza evidenza al lordo delle lesioni gastriche.
Lesioni ghiandolari sono stati definiti come la mucosa avere un aspetto anormale macroscopica cioè iperemiche, spessore maggiorato, erosioni o ulcere . Le posizioni anatomiche delle lesioni sono stati notati come: La regione cardias, corpus o antro (Fig. 6). Figura 6 regioni anatomiche dello stomaco aperto lungo la grande curvatura. La regione non-ghiandolare ha un epitelio appare bianca, considerando che la regione ghiandolare è tonalità di rosso. Sono separati dal Margo plicatus
. Le tre regioni campionati includono: Cardia come la piccola superficie della striscia appena sotto e lungo il Margo plicatus
, la regione corpus contenente acido, pepsinogeno e muco che secernono ghiandole (rosso scuro) e la regione antro contenente muco primarly e gastrina secernono ghiandole.
campionamento procedura
da ogni stomaco con lesioni ghiandolari, tre campioni di tessuto dove ottenuti dalla lesione più grande (a, B, C) e tre accoppiato normali campioni di tessuto appare (a, b, c) dal medesimo regione anatomica, ma distanti almeno almeno 5 cm. A /a: un piccolo, dimensioni biopsia (0,5 × 0,5 cm) campione della mucosa è stato ottenuto per il test dell'ureasi immediato con il Pyloritek ® test secondo la fabbrica istruzioni. I test sono stati letti dopo un tempo standard 60 minute e risultati riportati come positivi o negativi. I campioni B /b: un campione di tessuto a tutto spessore 3 × 3 cm incluso mucosa e sottomucosa sono stati ottenuti per i pesci e fissato nel 10% formalina tamponata. . Dopo 24 ore di fissazione i campioni sono stati trasferiti al 70% di etanolo, inclusi in paraffina, sezionati a 3 micron e montati su SuperFrost /più diapositive (Menzel-Glaser, Braunschweig, Germania)
campioni C /C: una terza coppia di tessuto campioni per la clonazione e il sequenziamento è stato ottenuto e Snap congelati con ghiaccio secco (Se la dimensione della lesione permesso).
dalle sette stomaci di controllo senza lesioni gastriche macroscopiche, i campioni a, B e C sono stati presi dalla mucosa normale apparizione del antro. Tre di questi cavalli sono stati inoltre sottoposti a campionamento nel cardias, corpus e del duodeno pure.
Le procedure di campionamento ha avuto luogo da agosto a ottobre 2007. I dati precedenti in merito precedente la salute dei cavalli non potevano essere ottenuti.
Fluorescent In Situ ibridazione per i batteri Compra di rilevazione microbica, le sezioni di tessuto sono stati ibridati simultaneamente con due 16S rRNA sonde marcate con diversi fluorofori. La sonda oligonucleotide S-D-BACT-0338-a-A-18 di targeting batteri (5'GCTGCCTCCCGTAGGAGT3 ') [34] era 5' etichettato con l'isotiocianato di fluoresceina e con isotiocianato Cy3 derivata. Il HEL717 sonda oligonucleotide mira il genere Helicobacter (5'AGGTCGCCTTCGCAATGAGTA3 ') [35] era 5' marcato con Cy3 derivato isotiocianato. Per verificare i risultati di clonazione di un terzo e quarto della sonda, LC-gProt-1027-AA-17 (5'GCCTTCCCACATCGTTT3 ') mira 23S rRNA di Gammaproteobacteria era 5' marcato con l'isotiocianato di fluoresceina e la sonda SG-Enteroco-184 (5'CAAATCAAAACCATGCGG3 ') è stato etichettato Cy3 mira 16S rRNA di Enterococcus spp
[36]. Tutte le sonde sono stati sintetizzati in tecnologia del DNA, Aarhus, Danimarca. I vetrini sono stati deparaffinate in xilene e trasferiti al 100% di alcool per 30 min prima di ibridazione. L'ibridazione è stata effettuata a 45 ° C con 40 ml di tampone di ibridazione (100 mM Tris [pH 7,2], 0,9 M NaCl, 0,1% sodio dodecil solfato) e 200 ng di ogni sonda per 16 ore in una diapositiva Rack Sequenza (Thermo Shandon, Cheshire, UK). I campioni sono stati quindi lavati tre volte in preriscaldata (45 ° C) tampone di ibridazione per 15 minuti e successivamente tre volte in soluzione preriscaldata (45 ° C) di lavaggio (100 mM Tris [pH 7,2], 0.9 M NaCl). I campioni sono stati risciacquati in acqua, l'aria secca e montato in Vectashield (Vector Laboratories Inc., Burlingame, CA, USA) per l'epifluorescenza. Un microscopio a epifluorescenza Axioimager M1 attrezzato per epifluorescenza con una lampada da 100 W HBO e set di filtri 43 e 38 sono stati usati per visualizzare i Cy3 e fluoresceina, rispettivamente. Le immagini sono state ottenute utilizzando una versione 3 FireWiremonocrome fotocamera AxioCam MRm e la versione del software AxioVision 4.5 (Carl Zeiss, Oberkochen, Germania)
. Valutazione della epifluorescenza è stata eseguita dalla descrizione della somma soggettivo, l'aspetto morfologico e la posizione delle cellule fluorescenti evidente in ogni campione di tessuto. In aggiunta, tutte le sezioni di tessuto sono state colorate da H & amp; E e valutati istopatologico
amplificazione 16S rDNA e la clonazione
Dopo il rilevamento di batteri a base di pesce, sono stati scelti i campioni secondari da cavalli che dimostrano batteri di varie morfologie per 16S rRNA gene. clonazione. Il DNA è stato isolato da campioni di tessuto 4 utilizzando il kit Easy-DNA (Invitrogen, Tåstrup, Danimarca) secondo le istruzioni del produttore. Il gene rRNA 16S è stato amplificato utilizzando primer SD-Bact-0008-AS-20 (5'-AGAGTTTGATCMTGGCTCAG-3 ') [37] e S - * - Univ-1492-AA-19 (5'-GGTTACCTTGTTACGACTT-3') [38]. PCR bicicletta consisteva di una denaturazione iniziale a 94 ° C per 6 min; seguita da 30 cicli di denaturazione a 94 ° C per 30 s, ricottura a 55 ° C per 45 s e estensione a 72 ° C per 2 min; e una estensione finale a 72 ° C per 3 min. Il DNA amplificato è stata verificata mediante elettroforesi su gel di agarosio. I prodotti di PCR sono stati purificati utilizzando il kit di purificazione QIAquick PCR colonne (Qiagen GmbH, Hilden, Germania). Per creare blunt-ended DNA quanto segue è stato mescolato in una provetta da 0,5 ml, 4 ml di 5 × T4 DNA polimerasi tampone, 14,7 ml di prodotto purificato PCR 0.8 ml di dNTP (2,5 mmol l -1 ciascuno) e 0,5 ml (1,2 U) di polimerasi T4 DNA (Invitrogen) e incubate a 12 ° C per 15 min. La polimerasi T4 DNA era inattivato al calore, e il DNA blunt-ended è stato purificato utilizzando le colonne kit di purificazione PCR QIAquick (Qiagen GmbH) ed eluito in un volume finale di 10 ml di acqua bidistillata. In seguito le descrizioni del produttore la clonazione è stata effettuata utilizzando un ottuso TOPO kit di clonazione Zero (Invitrogen). Dieci colonie di ogni clonazione sono state raccolte e sequenziati su un analizzatore sequenza automatica (ABI PRISM 373 DNA Sequencer, PE Biosystems, Foster City, CA, USA) utilizzando i due primer vettoriali standard (T3 e T7) incluse nel kit. La sequenza è stata assemblata in versione Bionumerics 4.0 (Applied Math, Sint-Martens-Latem, Belgio) e controllato per chimere sia facendo saltare le singole sequenze in GenBank http:.... //Www NCBI nlm NIH gov e dal software versione 1.1 Codone http:... //www Cardiff ac uk /biosi /ricerca /BIOSOFT /. L'analisi filogenetica dei cloni appartenenti al Escherichia
genere è stato fatto scaricando 16S rRNA sequenze geniche più di 1200 bp dal database PSR v.9 di Escherichia
tipo di ceppi http: //. Rdp CME . msu. edu. Le sequenze sono stati tagliati alla stessa lunghezza di 1327 bp e due a due allineate (UPGMA) seguiti da un allineamento di sequenze globale. Un albero filogenetico finale è stato costruito utilizzando l'algoritmo reparto dove Enterobacter sakazakii
(AB004746) è stato utilizzato come outgroup.
Dichiarazioni
Ringraziamenti
Gli autori desiderano ringraziare Hanne H. Møller, Katja Kristensen e Johanna Z Amenuvor per l'assistenza tecnica nei laboratori. Anche grazie a Stina Vesterholm per aiutare i tessuti di raccolta. Questo lavoro è stato sostenuto da di Kongeriget Danmark Horseinsurance g /s e Intervet Danimarca. Gli sponsor hanno avuto alcun coinvolgimento nella parte pratica o le conclusioni di questo studio.
Autori fascicoli presentati originali per
di seguito sono riportati i link ai file degli autori originali inviati per le immagini. 'file originale per la figura 1 12866_2009_1040_MOESM2_ESM.tiff Autori 12866_2009_1040_MOESM1_ESM.tiff autori file originale di' file originale per la figura 3 12866_2009_1040_MOESM4_ESM.tiff Autori figura 2 12866_2009_1040_MOESM3_ESM.pdf Autori file originale per la figura 4 file originale 12866_2009_1040_MOESM5_ESM.tiff degli autori per la figura 5 file originale 12866_2009_1040_MOESM6_ESM.jpeg degli autori per la figura 6

Other Languages