Stomaco Salute > ricerche > L'immunizzazione con il immunodominante Helicobacter suis ureasi subunità B induce una protezione parziale contro l'infezione da H. suis in un modello murino

L'immunizzazione con il immunodominante Helicobacter suis ureasi subunità B induce una protezione parziale contro l'infezione da H. suis in un modello murino

L'immunizzazione con il immunodominante Helicobacter suis
ureasi subunità B induce una protezione parziale contro H. suis
infezione in un modello di topo
Abstract
Helicobacter
(H.
) suis
è un suino e agente patogeno gastrica umana. Gli studi precedenti nei topi hanno dimostrato che un H. suis
infezione non si traduca in immunità protettiva, mentre l'immunizzazione con H. suis
lisato a cellula intera (lisato) protegge contro una successiva infezione sperimentale. Pertanto, bidimensionale elettroforesi su gel di H. suis
proteine ​​è stata eseguita seguita da immunoblotting con pool di sieri da H. suis
- infettato topi o topi immunizzati con lisato. reattività debole contro H. suis
proteine ​​è stata osservata in post-infezione sieri. I sieri di topi immunizzati lisato-, tuttavia, ha mostrato immunoreattività contro un totale di 19 spot proteici che sono stati identificati mediante LC-MS /MS. Il H. suis
ureasi subunità B (UreB) ha mostrato reattività più pronunciato contro sieri di topi lisato-immunizzati e non è stata rilevata con il siero di topi infetti. Nessuno dei pool di sieri rilevato H. suis
neutrofili-attivando proteina A (NAPA). L'efficacia protettiva del vaccino intranasale di topi BALB /c con H. suis
UreB e Napa, sia ricombinante espresso in Escherichia coli
(rUreB e rNapA, rispettivamente), è stato confrontato con quello di H. suis
lisato. Tutti i vaccini contenevano tossina colerica come coadiuvante. Immunizzazione di topi con rUreB e lisato indotto una significativa riduzione di H. suis
colonizzazione rispetto al suis non vaccinati H.
-infected controlli, mentre rNapA ha avuto alcun effetto protettivo significativo. Probabilmente, una combinazione di risposte Th1 e Th17 locali, accompagnata da risposte anticorpali svolgono un ruolo nella immunità protettiva contro H. suis
infezioni.
Introduzione
Helicobacter
(H.
) suis
è un patogeno diffusione in tutto il mondo, colonizzando soprattutto i maiali. Un'infezione con questo batterio Gram-negativo è stato associato con ulcere della mucosa non ghiandolare gastrica [1, 2] e provoca gastrite e diminuzione di peso al giorno [3] nei suini. H. suis
è anche il non-Helicobacter pylori Helicobacter
specie più diffuse negli esseri umani che soffrono di disturbi gastrici [2] e maiali possono servire come fonte di H. suis infezioni
per gli esseri umani [2, 4 ]. Controllo di H. suis
infezioni da terapia antibiotica a base non è raccomandato in parte a causa di un aumentato rischio di sviluppare acquisito resistenza antimicrobica in H. suis
ceppi e nei batteri appartenenti al normale microbiota suina [5]. Immunizzazione contro H. suis
può quindi rappresentare una valida alternativa. Fino ad oggi, però, pochi studi hanno affrontato la vaccinazione contro questo patogeno suina e zoonotici.
Precedenti studi in un modello di topo hanno dimostrato che un H. suis
infezione non si traduca in immunità protettiva, mentre la vaccinazione sulla base di omologa (H. suis
) o eterologo (H.
bizzozeronii o H. cynogastricus
) lisato intero-cellulare indotta una riduzione o addirittura clearance completa della colonizzazione gastrica con H. suis
[6]. Tuttavia, l'uso di questo tipo di vaccini presenta però degli inconvenienti, tra cui la laboriosa la coltura in vitro di H. suis
, che si traduce in difficoltà di produrre l'antigene sufficiente. Inoltre, lisati di cellule intere possono contenere sia antigeni protettivi e antigeni soppressione di protezione [7]. Un vaccino subunità efficace potrebbe essere una valida alternativa per il controllo di H. suis
infezioni. Immunoproteomics è un approccio adeguato per la rapida identificazione delle proteine ​​candidate per la vaccinazione ed è stato applicato per studiare e sviluppare vaccini subunità per una vasta gamma di agenti patogeni [8].
Era l'obiettivo del presente studio per selezionare H. suis
proteine ​​che potrebbero indurre immunità protettiva contro le infezioni H. suis
. Pertanto, H. suis
proteine ​​riconosciute dal siero di topi immunizzati con H. suis
lisato a cellula intera e protetti contro l'infezione sono stati identificati mediante elettroforesi bidimensionale (2D) gel seguita da immunoblotting e LC-MS /SIGNORINA. Sera del H. suis
- infettato i topi sono stati anche inclusi, dal momento che l'infezione non si traduce in protezione. Sulla base di questa analisi, la immunoreattiva H. suis
ureasi subunità B (UreB) è stato selezionato per un ulteriore test in vivo. Come controllo abbiamo incluso il H. suis
proteina neutrofili attivante A (NAPA), che è stato precedentemente descritto come un possibile fattore di virulenza [9], ma non è stato riconosciuto dai sieri dei topi immunizzati con lisato a cellule intere. Successivamente, l'efficacia protettiva nei confronti di un suis H.
infezione di entrambi i vaccini subunità è stata valutata e confrontata con quella di H. suis
lisato in un modello standardizzato del mouse.
Materiali e metodi
ceppo batterico
In tutti gli esperimenti, H. suis
ceppo 5 (HS5, GenBank: ADHO00000000) è stato utilizzato. Questo ceppo è stato isolato dalla mucosa gastrica di un maiale secondo il metodo descritto da Baele et al. [10]
. Animali
Una settimana prima dell'inizio degli esperimenti, cinque settimane di età specifico patogeno femminile-free topi BALB /c sono stati ottenuti da un allevatore autorizzato (Harlan, Horst, Paesi Bassi). Gli animali sono stati alloggiati in trucioli di legno sterilizzati a filtro superiore gabbie. Essi sono stati alimentati con una dieta commerciale autoclavato (TEKLAD 2018S, HARLAN) e ha ricevuto l'acqua ad libitum
autoclave. Tutti gli esperimenti sugli animali di laboratorio sono stati approvati dal Comitato Etico e Cura degli animali della Facoltà di Medicina Veterinaria, Università di Gand
. Immunoproteomics di H. suis
bidimensionale elettroforesi su gel (2D-PAGE)
HS5 è stata coltivata come precedentemente descritto [11]. I batteri sono state raccolte mediante centrifugazione (5000 g
, 4 ° C per 10 min) e lavati quattro volte con soluzione salina equilibrata di Hank (HBSS). proteine ​​totali (proteine ​​solubili e insolubili) sono stati estratti in due fasi utilizzando il kit ReadyPrep ™ sequenziale Estrazione (Bio-Rad, Hercules, CA, USA) secondo le istruzioni del produttore. Al fine di ottenere buoni risultati 2D-PAGE, gli omogenati sono stati trattati con appositi additivi (5 mg inibitore della proteasi cocktail, 1 ml DNAsi I, 1 ml RNasi A, 10 inibitori della fosfatasi microlitri PP2 e PP3 (Sigma-Aldrich, Steinheim, Germania) ). Infine, la concentrazione proteica è stata determinata con il RC DC Protein Assay
(Bio-Rad) e le proteine ​​sono stati conservati a -70 ° C fino a nuovo uso. Un totale di 100 mg di proteine ​​HS5 sono state reidratate in 200 microlitri di buffer di reidratazione (7M dell'urea, 2M thioureum, 2% CHAPS, 0,2% vettore ampholyte pH3-4, 100mM ditiotreitolo (DTT) e blu di bromofenolo). I campioni sono stati assorbiti passivamente in un ReadyStrip (11 cm, pH3 a pH10, Bio-Rad) e concentrando isoelettrico è stata effettuata in un Protean IEF Camera (Bio-Rad) come precedentemente descritto [12]. Dopo isoelettrico focalizzazione, le strisce sono state equilibrate per 15 min a 1,5% DTT in tampone di equilibrazione (50 mM TrisHCl, pH 8.8 6M urea, 20% glicerolo, 2% SDS) seguito da un altro equilibrazione nel 4% iodoacetamide in tampone di equilibrazione. Gel elettroforesi è stata effettuata su 10% TrisHCl SDS-PAGE usando 150V per 30 minuti, seguita da 200V per 1 h. Due gel sono stati eseguiti in parallelo: uno era macchiato di Sypro® Rubino Gel Protein colorazione (Bio-Rad), mentre l'altro è stato utilizzato per immunoblotting (vedi Western Blotting descritto di seguito). Prima della colorazione, gel sono stati fissati in 10% MeOH, acido acetico 7%. Dopo la colorazione, H. suis
proteine ​​sono state visualizzate utilizzando il VersaDoc Imaging System (Bio-Rad)
siero piscine
Tre piscine di sieri del mouse sono stati utilizzati in questo studio:.
I sieri di topi immunizzati con H. suis
lisato a cellula intera (di seguito denominati "topi lisato-immunizzati") (n = 10
). Questi animali sono stati inoculati per via intranasale due volte con un intervallo di tre settimane con 100 mg HS5 lisato + 5 mcg tossina del colera (CT) (List Biological Laboratories Inc., Madison, NJ, USA). HS5 lisato è stato preparato come descritto in precedenza ma senza filtrazione finale del surnatante [6]. Tre settimane dopo l'ultima vaccinazione, il sangue è stato raccolto e sieri sono stati raggruppati. Questo protocollo di immunizzazione ha dimostrato di essere (parzialmente) protettivo contro H. suis
sfida [6] e l'effetto protettivo è stato confermato qui in un esperimento preliminare (dati non mostrati).

Sera da H. suis
topi -infected (qui di seguito denominati "topi infetti") (n = 10
). Questi animali sono stati inoculati intragastricamente con 200 microlitri di brodo Brucella a pH 5, contenente 10 8 preparate al momento H. suis
batteri [11]. Quattro settimane dopo l'infezione, il sangue è stato raccolto e sieri sono stati raggruppati.

I sieri di topi di controllo negativo (n
= 10). Questi animali hanno ricevuto HBSS intranasale due volte con un intervallo di tre settimane, seguite da inoculazione intragastric con 200 microlitri di brodo Brucella a pH5 (4 settimane dopo l'ultima vaccinazione sham). Dopo quattro settimane, il sangue è stato raccolto e sieri sono stati raggruppati.
Tutti i sieri sono stati conservati a -70 ° C fino a nuovo uso.
Western blotting
proteine ​​sono state elettrotrasferite dal gel su membrane di nitrocellulosa (Bio-Rad) come descritto altrove [12]. Le membrane sono state bloccate nel 5% di latte scremato in tampone fosfato (PBS) (tampone bloccante), incubato per una notte (ON) con i sieri del mouse diluito (1/100 in tampone di bloccaggio) a temperatura ambiente (RT), sciacquati in PBS con 0,3% Tween-20 (tampone di lavaggio) e incubate per 1 ora a temperatura ambiente con capra stabilizzato anti-topo immunoglobulina G (IgG) rafano-perossidasi (HRP) coniugata (1/1000 in tampone di bloccaggio, Pierce, Rockford, IL, USA). Dopo una fase di lavaggio in tampone di lavaggio, immunolocalizzazione di proteine ​​è stata effettuata la rilevazione chemiluminescenza potenziata con substrato Durata SuperSignal occidentale Dura Extended (Pierce). pattern proteici sono stati scansionati e digitalizzati utilizzando il Imaging System VersaDoc. Tutti gli esperimenti sono stati eseguiti in triplicato.
In-gel digestione delle proteine ​​e identificazione mediante spettrometria di massa
In-gel è stata effettuata la digestione delle proteine ​​come descritto da Cheung et al. [13]. Prima di spettrometria di massa dei peptidi isolati sono stati separati su una cromatografia U3000 nano-alte prestazioni (HPLC) (Dionex, Sunnyvale, CA, USA) come descritto in precedenza [14]
. L'identificazione dei peptidi è stata effettuata utilizzando un elettrospray ionizzazione quadrupolo tempo di volo spettrometria di massa (ESI-Q-TOF) Ultima (Waters, Milford, MA, USA), come descritto in precedenza [14]. L'analisi dei dati è stata effettuata contro l'Helicobacter
database di proteine ​​da NCBI (146 612 voci) utilizzando l'in-house motore di ricerca Mascot Daemon (2.3, Matrix Science, London, UK). Un errore di ricerca tolleranti stata eseguita con carbamidomethyl (C) come modifica fisso. Carbamidomethyl (N-terminale) e l'ossidazione (M) sono stati fissati come modifiche variabili. Peptide di massa della tolleranza tolleranza e la massa frammento è stato fissato a 0,35 e 0,45 Da Da, rispettivamente. Massimo due miscleavages sono stati autorizzati. Le proteine ​​sono state considerate solo essere correttamente annotato quando la significatività era inferiore a 0,05 (p
& lt; 0,05) ed almeno un peptide superato i criteri grassetto rosso richiesti da Mascot Daemon, indicando che almeno un peptide aveva rango 1 e un significato sotto 0.05.
unidimensionale elettroforesi su gel (1D-PAGE) e western blotting di rUreB
1D-PAGE di 10 mg ricombinante H. suis
ureasi subunità B (rUreB) è stata effettuata come descritto da Van Steendam et al. [12]. analisi preparazione Sera e Western Blot sono stati eseguiti come descritto sopra.
L'efficacia protettiva di ricombinante H. suis
proteine ​​in un modello murino
Preparazione di UreB ricombinante
Un frammento che codifica per la H. suis
sequenza UreB (GenBank tag locus HSUHS5_0285) è stato amplificato mediante PCR utilizzando una polimerasi Pwo con l'attività correzione di bozze (Roche, Mannheim, Germania) dal DNA di HS5 (primer forward: 5'-ATG AAA AAA ATC TCT AGG AAA GAA TAT G -3 '; primer reverse: 5'-CTA GTG ATG ATG GTG GTG ATG GAA CAA GTT GTA GAG TTG AGC -3') e clonati nella proteina vettore di espressione pET-24d. Il rUreB è stato espresso in E. coli
ceppo BL21 (DE3). Le cellule sono state lisato mediante sonicazione (5 volte per 30 s) in tampone contenente 50 mM Na.PO 4 pH7, 0,5M NaCl, 1M DTT, 1% Triton X-100 e 1mM PMSF. Dopo centrifugazione (4 ° C, 20 000 g
per 30 min), rUreB è stato purificato dalla frazione solubile usando Ni-cromatografia di affinità in tampone costituito da 1M NaCl, 50mM PBS, 1% Triton X-100, 250mM imidazolo e 10% glicerolo (suo GraviTrap, GE Healthcare Bio-Sciences AB, Uppsala, Svezia), seguita da gel filtrazione su un Superdex ™ 200 HR 16/60 colonna (GE Healthcare Bio-Sciences AB). Dopo la purificazione, rUreB è stato analizzato utilizzando SDS-PAGE e Western blot con anti-hexahistidine-tag anticorpo monoclonale di topo (Icosagen Cell Factory, Tartu, Estonia). Il detergente Triton X-100 è stato rimosso dal rUreB purificata utilizzando Pierce detergenti colonne rimozione Spin (Pierce) seguito le istruzioni del produttore. La concentrazione proteica è stata determinata con l'RC DC
proteine ​​Assay (Bio-Rad)
. Preparazione di ricombinante Napa
La proteina è stata espressa in E. coli
sistema di espressione con Gateway® Technology (Invitrogen, Carlsbad, CA, USA) nel modo seguente. Un frammento che codifica per il H. suis
sequenza neutrofili-attivando proteina A (NAPA) (GenBank tag locus HSUHS5_0014) è stato amplificato mediante PCR utilizzando una polimerasi Pwo con l'attività correzione di bozze (Roche) dal DNA di HS5 (primer forward: 5 ' - CACCATG AAAGCAAAAACAGTTGATGTACTC -3 '; inversione di primer: 5'-TTAAGCCAAACTTGCCTTAAGCATCC -3') e clonati nel ™ /TEV /D-TOPO® vettore pENTR e trasferito nel vettore di destinazione pDEST17 ™. Il plasmide pDEST17-NAPA selezionato è stato trasformato nel BL21-AI ™ E. coli
e successivamente coltivate a 37 ° C ad un OD 600 di 0,6-1,0 in Luria Broth addizionato con 50 pg /ml carbenicillina. Ricombinante H. suis
Napa (rNapA) l'espressione è stata indotta con l'aggiunta di 0,2% arabinosio L-. Dopo 4 ore di incubazione a 37 ° C, le cellule sono state raccolte e risospese in tampone di lisi: 50 mM TrisHCl, 100mM NaCl, 1% Triton X-100, 0,2 mg /ml di lisozima, 20 mg /mL DNAsi, inibitore della proteasi 1mM (Sigma) , e 1mM MgCl 2. Le cellule sono state lisato mediante sonicazione (5 volte per 30 s). corpi detriti cellulari e di inclusione sono stati isolati per centrifugazione a 4 ° C (20 000 g
per 30 min). I corpi di inclusione sono stati successivamente lavati due volte in base al seguente protocollo: il pellet è stato risospeso in tampone di lisi freddo, sonicato 5 volte per 30 s seguita da centrifugazione (4 ° C, 20 000 g
per 30 min). I corpi di inclusione sono stati lavati solubilizzati in tampone legante, pH 8 (6M guanidium HCl, 20 mM TrisHCl, 0,5M NaCl, 5 mM imidazolo, 1mM β-mercaptomethanol) per rotazione delicata per 1 ora a RT. materiale insolubile è stato rimosso mediante centrifugazione ad alta velocità a 4 ° C (100 000 g
per 30 min). rNapA è stato purificato dal surnatante chiarificato su una colonna Ni-Sepharose (suo GraviTrap, GE Healthcare Bio-Sciences AB) secondo le istruzioni del produttore. rNapA è stata eluita con tampone di eluizione, pH 8 (8M urea, 20 mM TrisHCl, 0.5M NaCl, 0.5M imidazolo, e 1mM β-mercaptoetanolo) e ON dializzata contro PBS a 4 ° C. In seguito, è stato analizzato utilizzando rNapA SDS-PAGE e proteine ​​concentrazione è stata determinata utilizzando RC DC
Protein Assay (Bio-Rad).
Esperimenti di immunizzazione e di infezione
Il disegno sperimentale è riassunto nella Figura 1. Cinque gruppi di 10 topi sono stati inoculati per via intranasale due volte con un intervallo di 3 settimane, ogni volta con 17,5 microlitri inoculo. Nei gruppi 1, 2 e 3 l'inoculo consisteva di HBSS con 5 mcg CT, contenente 30 ug rUreB, 30 mg rNapA e 100 ug HS5 lisato rispettivamente. Gruppi di 4 (gruppo sham-immunizzati) e 5 (gruppo di controllo negativo) sono state inoculate con HBSS. Tre settimane dopo la seconda vaccinazione intranasale, il sangue è stato raccolto da coda sanguinamento da cinque animali per gruppo e una settimana più tardi, tutti gli animali, ad eccezione del gruppo di controllo negativo, sono stati inoculati intragastricamente con 200 microlitri Brucella brodo a pH 5 contenente 10 8 vitali H. suis
batteri [11]. Il gruppo di controllo negativo è stato inoculato intragastricamente con 200 microlitri di brodo Brucella a pH5. Quattro settimane dopo l'inoculazione intragastrico, i topi sono stati sacrificati per dislocazione cervicale dopo anestesia isoflurano (ISOFLO, Abbott, IL, USA). Dagli animali sacrificati, il sangue è stato raccolto mediante puntura cardiaca sterile, centrifugato (1000 g
, 4 ° C, 10 min) e siero è stato congelato a -70 ° C fino all'utilizzo. Stomaci venivano asportate e sezionati lungo la grande curvatura. La metà degli stomaci, tra cui antro e fondo, è stato immediatamente messo in 1 ml di RNA Più tardi (Ambion, Austin, TE, USA) e conservato a -70 ° C per ulteriori RNA e DNA-estrazione. Una striscia longitudinale del tessuto gastrico è stato tagliato dall'esofago al duodeno lungo la grande curvatura per l'esame istopatologico. Figura 1 disegno sperimentale degli studi di vaccinazione. Per gruppo di 10 topi sono stati immunizzati per via intranasale due volte con intervallo di 3 settimane, ogni volta con 30 mcg rUreB + 5 mg tossina del colera (CT); 30 mcg rNapA + 5 mg CT, e 100 mg HS5 lisato + 5 mg CT (gruppi 1, 2 e 3, rispettivamente). Gruppi di 4 (gruppo sham-immunizzati) e 5 (gruppo di controllo negativo) sono stati inoculati con intranasale HBSS. Tre settimane dopo la seconda vaccinazione, il sangue è stato raccolto da 5 topi per gruppo e una settimana dopo i topi dei gruppi 1, 2, 3 e 4 sono stati intragastricamente inoculati con 108 praticabile H. suis
batteri. Gruppo 5 è stato intragastricamente inoculato con HBSS. Quattro settimane dopo la sfida intragastrico, sono stati sottoposti a eutanasia topi.
Quantificazione di H. suis
nello stomaco
Dopo lo scongelamento, i tessuti dello stomaco sono stati omogeneizzati (MagNAlyser, Roche, Mannheim, Germania) in 1 ml Tri Reagent® RT (MRC, Brunschwig Chemie, Amsterdam, Paesi Bassi) e il DNA è stato estratto dalla fase inter ed organica secondo le istruzioni del Tri Reagent® RT produttore. La carica batterica nello stomaco è stata determinata con il precedentemente descritti H. suis
specifica quantitativa real-time PCR (qPCR) [5]
. Analisi di citochine risposta stomaco
I livelli di espressione di IFN-γ, IL-4, IL-10, IL-17 e TNF-α sono stati valutati mediante qPCR utilizzando cDNA sintetizzati dal tessuto dello stomaco come precedentemente descritto [15]. Il ciclo soglia di valori (Ct) sono stati normalizzati per la media geometrica dei CT-valori dei geni di riferimento dopo che si è normalizzato i livelli di mRNA sono stati calcolati utilizzando il 2 -ΔΔCt metodo [16].
Misura della risposta anticorpale sierica mediante saggio di immunoassorbimento enzimatico (ELISA)
Il proteine ​​Detector kit ELISA ™ (KPL, Gaithersburg, MD, USA) è stato utilizzato per valutare rUreB-, rNapA-, e HS5 lisato specifico IgG nel siero. In breve, 96 piastre di fondo ben piane (Nunc Maxisorp, Nalge Nunc Int., Rochester, NY, USA) sono stati rivestiti con 2 mg /pozzetto di rNapA purificata, 1 mg /pozzetto di rUreB purificato, o 1 mg /pozzetto di H. suis
proteine ​​cellulari intere diluiti in 100 microlitri di tampone di rivestimento (24 h, 4 ° C). Dopo aver bloccato con 1% di albumina sierica bovina in PBS, 100 ml di siero diluito 1/400 è stato aggiunto a ciascun pozzetto. Dopo un ulteriore lavaggio, 100 ml di HRP-marcato anti-topo IgG (H + L) in una concentrazione finale di 50 ng per pozzetto è stato aggiunto. Cinque minuti dopo l'aggiunta di 2,2-Azino-bis (3-ethylbenzothiazoline-6-solfonico) (ABTS) soluzione di substrato perossidasi, assorbanza è stata letta a 405 nm (OD 405nm).
Istopatologico esame
Le strisce di tessuto gastrico longitudinali sono stati fissati in 4% tamponata con fosfato di formaldeide, elaborato da procedure standard e inclusi in paraffina. Per la valutazione della gastrite, ematossilina - eosina (HE) sezioni colorate su 5 micron sono stati ciecamente valutati sulla base del grado di infiltrazione dei linfociti, cellule del plasma e dei neutrofili, utilizzando una scala analogica visiva simile al sistema Sydney aggiornamento (su una scala da 0- 3) [17] con le seguenti specifiche per ogni punteggio gastrite: 0 = nessuna infiltrazione di mononucleare e /o di cellule polimorfonucleati; 1 = lieve diffusa infiltrazione di mononucleare e /o di cellule polimorfonucleati; 2 = moderata infiltrazione diffusa mononucleare e /o cellule polimorfonucleati e /o la presenza di uno o due aggregati infiammatori; 3 = contrassegnati infiltrazione diffusa mononucleare e /o cellule polimorfonucleati e /o la presenza di almeno tre aggregati infiammatorie.
Analisi statistica
normalità e varianza omogeneità dei dati sono stati analizzati utilizzando D'Agostino-Pearson e Shapiro- test di normalità Wilk. Differenze significative a H. suis
colonizzazione e l'espressione delle citochine mRNA tra i gruppi sono stati valutati mediante l'esecuzione di una via di analisi ANOVA. test di confronto multiplo di Bonferroni è stato utilizzato come post-hoc quando varianze uguali sono stati valutati. test post-hoc T3 di Dunnett è stato utilizzato quando non varianze uguali sono stati valutati. OD livelli 405nm da ELISA e punteggi di infiammazione istologici sono stati confrontati con l'analisi Kruskall-Wallis, seguito da un Mann-Whitney U
test. Per correlazioni tra diverse variabili, è stato calcolato il coefficiente rho di Spearman (ρ
). GraphPad Prism5 software (GraphPad Software Inc., San Diego, CA, USA) è stato utilizzato per tutte le analisi. Le differenze statisticamente significative tra i gruppi sono stati considerati a pag
& lt; 0.05.
Risultati
Immunoproteomics di H. suis
H. suis
proteine ​​sono state separate in 2D-PAGE (Figura 2a). Dopo 2D-immunoblotting con pool di sieri da lisato-immunizzati (Figura 2b) o H. suis
animali -infected (Figura 2C), sono stati selezionati un totale di 19 punti di proteine ​​immunoreattive. Queste macchie sono stati abbinati con le macchie proteina che potrebbe essere visto in parallelo 2D-PAGE (Figura 2a). Poco reattività contro H. suis
proteine ​​è stata osservata in post-infezione sieri rispetto alla alta reattività contro sieri dei topi immunizzati lisato-. Quando la macchia è stato sondato con un pool di sieri ottenuti da topi di controllo negativo, non specifici spot proteici immunoreattive sono stati rilevati (file1 supplementare). Macchie di interesse (n
= 19) sono stati tagliati fuori dal gel, digerite e identificati mediante analisi LC-MS /MS. I risultati dettagliati di queste proteine ​​sono riassunte nella tabella 1. punti con la più alta reattività (spot da 1 a 5) sono stati identificati come UreB. H. suis
chaperonin GroEL, illustrato come macchie 9 e 10 in figura 2a, ha mostrato anche una forte ibridazione con il siero di animali lisato-immunizzati. Inoltre, sieri di topi immunizzati lisato-ha mostrato una forte reattività contro la proteina accessoria ureasi (Ureh) e l'ureasi subunità A (urea) (spot da 15 a 19), che è stato meno pronunciato nel gruppo infetto. reattività debole contro la maggior Flaa flagellina (spot da 11 a 13) era presente in entrambe le macchie. profilo Figura 2 H. suis 2D-proteoma (A) e le macchie occidentali di un 2D-gel duplicato reagito con sieri pool di topi immunizzati lisato-(B) o di H. suis topi -infected (C). 100 mg di estratto proteico totale di H. suis
era separato da 2D-elettroforesi utilizzando pH3 lineare a 10 pendenza nella prima dimensione e il 10% TrisHCl SDS-PAGE nella seconda dimensione. Le proteine ​​separate sono state rilevate da SYPRO®Ruby proteine ​​colorazione. Le aree scatolate indicano dove antigeni immunoreattivi state escisse dal gel e sottoposti a LC-MS /MS. proteine ​​identificate sono indicate con i numeri pronti indicate nella tabella 1. Scatole e numeri in rosso sono stati identificati come UreB. La posizione del peso molecolare (MW) è dato a destra, e il pH è dato alla parte inferiore.
Tabella 1 immunoreattiva proteine ​​di H. suis identificati da LC-MS /MS
Spot No.1

nome Protein
NCBI ID2
Gene
Pi3
MW3
No. peptidi abbinati
Mascot score4
Cov. (%) 5
1
Ureasi subunità B
EFX42254
ureB
5,97
62,967
117
1589
72
2
ureasi subunità B
EFX42254
ureB
5,97
62,967
80
1042
58
treonil-tRNA sintetasi
EFX41598
THR
6,34
69,315 7
186
60 3
ureasi subunità B
EFX42254
ureB

5.97
62,967
80
903
46 4
ureasi subunità B
EFX42254
ureB
5,97
62,967
4
103
6
5
ureasi subunità B
EFX42254
ureB
5,97
62,967 4
103
6
6
30S proteina ribosomale S1
EFX42427
RPSA
8.29
64,051
23
625
28
Quinone-reattiva Ni /Fe idrogenasi, subunità grande
EFX41851
hydB
8.22
64,943
19
520
28
ureasi di H. heilmannii
AAA65722
8.86
25,844
8
258
26 7
Metil-accettando chemiotassi proteina
EFX43528
7.1
48,907
35
905
50

Other Languages