žalúdok zdravie > žalúdočné Cancer > Ploche ONE: SIRT3 Zvyšuje glykolýzu a proliferácie v SIRT3-Vyjadrenia žalúdku nádorových buniek

Ploche ONE: SIRT3 Zvyšuje glykolýzu a proliferácie v SIRT3-Vyjadrenia žalúdku nádorových buniek


abstraktné

SIRT3 je kľúčovým NAD + - závislý proteín Deacetylase v mitochondriách cicavčích buniek, fungovanie, aby sa zabránilo starnutia buniek a transformácie prostredníctvom regulácie mitochondriálnej metabolickej homeostázy. Avšak, SIRT3 je tiež zistené, že exprimujú v niektorých ľudských nádorov; jeho úloha v týchto nádorových buniek exprimujúcich SIRT3 sa musí vysvetliť. Táto štúdia ukázala, že expresia SIRT3 bola zvýšená v skupine buniek karcinómu žalúdka v porovnaní s normálnou žalúdočnej epiteliálne bunky. Aj keď SIRT3 hladiny expresie boli v žalúdočných nádorových tkanivách vyššia v porovnaní so susednými nenádorových tkanív, SIRT3 pozitívne nádorové bunky boli v žalúdočných rakoviny čreva typu než karcinómov žalúdka difúzny typ častejšie zistené, čo naznačuje, že SIRT3 je spojený s podtypy žalúdočných rakovina. Nadmerná expresia SIRT3 podporoval proliferáciu buniek a zvýšenú tvorbu ATP, glukózy, tvorbe glykogénu, MnSOD aktivita a produkcia laktátu, ktorá bola inhibovaná SIRT3 príklepu, čo naznačuje, že SIRT3 hrá úlohu v preprogramovanie bioenergetický v žalúdočných nádorových buniek. Ďalšia analýza ukázala, že SIRT3 styku s a dezacetylované na laktátdehydrogenázy A (LDHA), čo je kľúčový proteín v regulácii anaeróbne glykolýzu, zlepšovanie LDHA aktivitu. V konzistencie, zhluk génov glykolýzy asociovaných bola up-regulovaná v žalúdočných nádorových buniek SIRT3-expresiou. Tak, okrem dobre zdokumentované SIRT3 sprostredkované mitochondriálnej homeostázy v normálnych bunkách, SIRT3 môže zvýšiť glykolýzy a proliferáciu buniek v nádorových bunkách exprimujúcich SIRT3

Citácia :. Cui Y, Qin L, Wu J, Qu X, Hou C, Sun W, et al. (2015) SIRT3 Zvyšuje glykolýza a proliferácie v SIRT3-Vyjadrenia žalúdočné rakovinové bunky. PLoS ONE 10 (6): e0129834. doi: 10,1371 /journal.pone.0129834

Editor: Xianglin Shi, University of Kentucky, Spojené štáty

prijatá: 16. apríla 2015, Prijaté: 13.května 2015; Uverejnené: 29.júna 2015

Copyright: © 2015 Cui et al. Toto je článok o otvorenej distribuovaný pod podmienkami Creative Commons Attribution licencie, ktorá umožňuje neobmedzené použitie, distribúciu a reprodukciu v nejakom médiu, za predpokladu, že pôvodný autor a zdroj sú pripísané

Data Dostupnosť: Všetky relevantné údaje spadajú do papiera a jeho podporné informácie súbory

Financovanie :. Táto štúdia bola čiastočne podporovaná Národná prírodná Science Foundation Číny, Key Program (30930105), Národné 12-5 podpora projektový plán ministerstva vedy and Technology of China (2012BAH30F03), Národná prírodná Science Foundation of China (31070740) sa 985 a 211 Projekty Xi'an Jiaotong University (JKL) a National Cancer Institute RO1 grant CA152313-01-A1 (JJL).

konkurenčné záujmy :. autori vyhlásili, že žiadne konkurenčné záujmy neexistujú

Úvod

Sirtuins, rodina NAD + - závislé histondeacetyláz (HDACs) v cicavčích bunky, sa podieľajú na širokej škále fyzikálnych procesov, vrátane prežívanie buniek, apoptózu, metabolizmus, reakcia na stres, starnutie a dlhovekosť [1,2]. Medzi siedmimi Sirtuin členov (SIRT1-7), SIRT3 je najlepšie charakterizuje mitochondriálnej Sirtuin, fungujúci na reguláciu mitochondriálnej proteíny zapojené do oxidatívny fosforylácie, oxidácie mastných kyselín, cyklu močoviny, a antioxidačné odpovede [2-9]. Niekoľko štúdií vyzdvihol úlohu SIRT3 v metabolizme a homeostázy v normálnych bunkách a odhalil nové ciele a substráty pre SIRT3 závislé deacetyláciou [10]. Kim et al uvádzajú, že SIRT3 je kľúčovým mitochondrií proteín, a nedostatok expresie SIRT3 je spojená s zvýšené poškodenie mitochondriálnej DNA a starnutia, ako aj zvýšenie potenciálu na Ras-indukovanej bunkovej transformácie a aktivácia MnSOD SIRT3 sprostredkované prispieva k mitochondriálnej homeostázy [11,12]. Na podporu, ľudské embryonálne obličkové bunky 293 (HEK293 bunky) vykazujú zvýšené expresie SIRT3 pod oxidačný stres, čo vedie k aktivácii a deacetyláciou MnSOD [13]. SIRT3 sa predpokladá, že funguje ako tumor supresorového génu a hrá kľúčovú úlohu pri zvyšovaní bunkovej homeostázy proti starnutiu a rakoviny.

Avšak, niektoré nádorové bunky vykazujú expresiu SIRT3 a potenciálnu úlohu SIRT3 v týchto nádorových bunkách , a to najmä jeho potenciál vzťah k agresívnej fenotyp, bola sporná [14]. SIRT3 výraz je nižšia, alebo nedetegovateľnou v rade ľudských nádorov, vrátane rakoviny prsníka, glioblastómu, rakoviny hrubého čreva, a osteosarkóm, prostaty a rakoviny vaječníkov [11,15,16]. SIRT3 indukuje zástavu rastu a apoptózu selektívne umlčanie Bcl-2 v bunkách HCT116 cez moduláciu JNK2 signálny dráhu [17]. Tiež, SIRT3 sa uvádza prispieť k zvýšeniu citlivosti na ľudských leukemických buniek k chemoterapii prípadne prostredníctvom indukcie apoptózy mitochondrii sprostredkované [18]. Na druhej strane, SIRT3 expresia sa tiež nachádza sa zvýši na rakovinu ústnej, uzlín rakoviny prsníka, rakoviny pažeráka, a karcinómy štítnej žľazy; a zvýšená SIRT3 je spojená s vyššou malígnym fenotypom a downregulace SIRT3 zvyšuje citlivosť nádoru na liečbu anti-rakoviny [19-23]. Tieto výsledky upozorniť inú úlohu SIRT3 v špecifických nádorov, ktoré je potrebné objasniť.

Rakovinové bunky sú metabolicky aktívne a spotrebuje viac paliva než mobilný normálnych bunkách. Avšak rakovinové bunky spoľahnúť na hlavne na syntézu ATP aeróbne glykolýzy, rys známy ako Warburg efekt [24]. Ako aeróbne glykolýza sa predpokladá, že chráni nádorové bunky tvoria oxidačný stres, pretože mitochondriálnej respirácie je hlavným zdrojom intracelulárneho ROS [25]. Laktát dehydrogenázy A (LDHA) je enzým, ovládajúci vzájomnú medzi pyruvátu a L-laktát reverzibilne v poslednom kroku anaeróbnej glykolýzy [26]. Inhibícia LDHA znižuje karcinogénne účinky so zvýšenou mitochondriálnej spotreby kyslíka a zníženie potenciálu mitochondriálnej membrány [26], a celková bunková ATP výroby a glykolýza [27].

V tejto štúdii sme skúmali potenciálnu úlohu SIRT3 v žalúdku rakovinové bunky, ktoré vyjadrujú SIRT3. Expresia SIRT3 bola spojená s agresívnym rastom, ktorý bol sprostredkovaný SIRT3-deacetylovaného a aktívnym LDHA, posilnenie rastu baktérií a expresie skupiny génov glykolýzy asociovaných. Tak SIRT3-LDHA sprostredkovaná glykolýza metabolizmus môže byť potenciálny terapeutický cieľ pre liečbu rakovinové bunky, ktoré vyjadrujú SIRT3.

Materiály a metódy

Bunkové línie a kultúra

Ľudská rakovina žalúdka bunkové línie MGC-803, HGC-27, SGC-7901 [28], a AGS [29] a imortalizované ľudské žalúdočné epiteliálne bunková línia GES-1 [30], boli udržiavané v médiu RPMI-1640 (Invitrogen) doplnenom 10% fetálnym hovädzím sérum a 1% penicilín /streptomycín, a kultivované pri teplote 37 ° C v atmosfére 5% CO2.

Imunoprecipitácia a western blot

Subkonfluentní bunky boli lyžovanie a lyzáty boli inkubované s proteínom a /G agarosových guličiek plus odporúčané množstvo protilátok proti buď SIRT3 (Cell Signaling Technology), alebo LDHA (Santa Cruza) pri teplote 4 ° C cez noc. Vzorky boli odstredené a separované SDS elektroforézy na polyakrylamidovom gélu a elektroblot na nitrocelulózové membrány. Po blokovaní 5% odtučneným mliekom v TBST, boli membrány inkubované s primárnou protilátkou pri 4 ° C cez noc s následnou inkubáciou s sekundárnou protilátkou po dobu 1 hodiny pri teplote miestnosti. Proteínov, boli vizualizované pomocou ECL detekčný súpravy (Thermo Fisher).

Imunohistochemické stanovenie

Patologické šmykľavky na žalúdočné rakovinu s priľahlými normálnych tkanivách boli analyzované imunohistochemicky testom sa vykonávali podľa pokynov výrobcu. Súprava Polymer detekcie pre analýzu imunohistochemického bol zakúpený od Zhongshan Golden Bridge biotechnológie. Stručne povedané, parafínové rezy boli zbavené vosku a re-hydratovaný v etanole (100%, 90% a 75%). Rezy boli inkubované s 3% H 2O 2 pri teplote miestnosti po dobu 10 minút a potom blokovali s non-imunitný kozieho séra pri teplote miestnosti po dobu 15 minút. Rezy boli potom inkubované s primárnou protilátkou, aby SIRT3 (Cell Signaling Technology) po dobu 2 hodín pri teplote miestnosti a následne anti-králičie sekundárne protilátky inkubácie po dobu 15 minút pri teplote miestnosti. Rezy boli potom inkubované s detekčným činidlom DAB po dobu 2 minút každý, kontrastne hematoxylínom a dehydraded v etanole (90% a 100%). Rezy boli namontované a farbenie bola analyzovaná pod mikroskopom.

Plasmid konštrukcie a bunková transfekcia

SIRT3 celej dĺžke cDNA sa syntetizuje za použitia RT-PCR o celkovej RNA extrahované z GES-1 bunky ako šablóna (primery: 5 'CCGCGGTACCATGGCGTTGTGGGGTTG 3' a 5 'CCGCTCTAGACTATTTGTCTGGTCCATCAAGC 3'). CDNA sa potom klonom do pcDNA3.1 + expresného vektora (Invitrogen). PGPH1 /GFP /Neo-SIRT3-zhrnie plazmid zameraný na ľudské SIRT3 (5 'CTTGCTGCATGTGGTTGAT 3') a ovládacie zhrnie plazmid boli získané od GenePharma. K vytvoreniu stabilných transfektantů, AGS a SGC-7901 bunky boli prenesené s použitím Lipofectaminu 2000 (Invitrogen) činidlá a stabilné transfektanty boli selektované 400ug /ml G418 (Gibco).

Bunková proliferácia a clonogenicity test
< p> teste proliferácie bunky boli nanesené na 6-jamkové doštičky v 2 x 10 4 buniek /jamka. Proliferácia buniek bola vypočítaná v dňoch 2, 4, 6, a 8 po vysiatí. Pre clonogenicity testu boli bunky nanesené na 6-jamkové doštičky s rôznymi počty buniek a kultivované po dobu 14 dní a kolónie potom boli zafarbené kryštálovú violeťou a počet kolónií (viac ako 50 buniek /kolónie) sa počíta v súlade so zavedenými metódami [31].

meranie glukózy, laktátu a glykogénu

fenolovej červene médium bez bola použitá pre kultúry buniek v 6-jamkové doske po dobu 24 hodín a úrovňou príjmu glukózy a laktátu generácie boli merané pomocou Kit vyšetrenie glukózovej a kyseliny mliečnej Kit (Jiancheng bioinžinierstva Institute). Relatívna hodnoty boli normalizované na počte buniek z každej jamky. Bunkové hladiny glykogénu boli detekované za použitia glykogénu Assay Kit (Biovision). Stručne povedané, 1 x 10 6 bunky boli homogenizované v 200 ul vody na ľade a Homogenát sa varí po dobu 5 minút na inaktiváciu enzýmov a centrifugovány pri 13000 otáčkach za minútu po dobu 5 minút pri 4 ° C pre odstránenie nerozpustného materiálu. Produkcia glykogénu bola meraná s hodnotou OD pri 570 nm.

Meranie produkcie ATP
boli merané

Bunková ATP a ROS úrovne, ako bolo opísané skôr [32]. Bunky kultivované v 6-jamkové doštičky po rôznych ošetrení, boli lyžovanie a bunkovej ATP boli merané s ATP Bioluminiscencia Assay Kit (Sigma). Pre meranie produkcie ATP glykolýzy sprostredkované, bunky boli ošetrené s 2 uM rotenón po dobu 24 hodín pred meraním.

Meranie ROS generácie

Cellular ROS generácia bola testovaná s 5- (a 6) karboxy-2 ', 7'-dichlorodihydrofluorescein diacetát (DCFDA) metóda s použitím doštičiek spektrometra (Thermo Fisher) pri nm /nm vlnovej dĺžke 488 530.

MnSOD aktivita

Bunky kultivované v 6-jamkové dosky boli lyžovanie a MnSOD aktivita bola stanovená pomocou WST-8 metódami s použitím MnSOD testovacie sady (Beyotime) podľa inštrukcií výrobcu.

karcinogenity testy u nahých myší

SGC7901 bunky (7,5 x 10 < sup> 6) sa SIRT3 nadmernou expresiou alebo porazený sa suspenduje v 0,1 ml PBS a vrúbľovať do jedného boku 5 týždňov starí samci Balb /c athymických nahých myší a u 28 th deň po inokulácii, kedy maximálny objem nádoru (~ 1500 mm 3) dosiahol v kontrolnej skupine, experimenty boli ukončené a všetky nádory z každej skupiny boli vyrezané a zvážené. Experimentálny postup zahŕňajúci živočíšne testov bola vykonaná v súlade s inštitucionálnymi smernicami; Care and Use výboru Institutional Animal (IACUC) pri Xian Jiao Tong University výslovne schválil túto štúdiu (protokol # 120181).

Laktát- dehydrogenáza test

laktátdehydrogenázy aktivita bola stanovená po stanoveného protokolu meraním rýchlosti redukcie v absorbancie pri vlnovej dĺžke 340 nm v dôsledku oxidácie NADH [27]. V stručnosti, bunky boli kultivované v 10 cm miskách a homogenizované v PBS na ľade. Homogenát boli pridané do pufra obsahujúceho 6,6 mM NADH, 30 mM pyruvátu sodného a 0,2 M Tris-HCl, pH 7,3 a zmiešané. Inkubuje sa zmes po dobu 5 minút, aby sa dosiahlo teploty rovnováha a záznam rýchlosti poklesu absorbancie pri 340 nm.

SIRT3 in vitro
deacetyláciou test

Human SIRT3 rekombinantného enzýmu ( BPS) bol inkubuje sa s ním s L-laktátdehydrogenázy z hovädzieho srdca (Sigma) v reakčnom pufri (50 mM NaCl, 4 mM MgCl 2, 10 mM NAD +, 50 mM DTT, 50 mM Tris, pH 8,0) s /bez inhibítora SIRT3 nikotínamid (NAM, 10 mM) pri 37 ° C počas 1,5 hodiny a potom sa reakcie boli použité pre test aktivity LDHA popísané vyššie.

Real-time PCR

celková RNA bola izolovaná s použitím TRIzolu reagent (Invitrogen) a následným spracovaním s fenol /chloroformom a vyzrážaním s 2-propanolom. Celková RNA peleta sa premyje 75% etanolom a resuspendované vo vode. RNA sa podrobí reverznej transkripcii s PrimeScript RT-PCR Kit (Takara) a kvantitatívne real-time PCR analýzy génov záujmu, bolo vykonané s použitím SYBR PremixExTaq II Kit (Takara) podľa inštrukcií výrobcu. Údaje boli normalizované na úrovni y-tubulínu.

Imunofluorescenčný

AGS buniek nasadených na krycom sklíčku v 6-jamkové doštičky boli fixované v 4% paraformaldehydu po dobu 10 minút a blokované v 1% BSA po dobu 1 hodiny pri teplote miestnosti. Inkubujte buniek s primárnymi protilátkami proti SIRT3 a LDHA pri teplote 4 ° C cez noc, s následnou inkubáciou s fluorescenčným-konjugovanou sekundárnou protilátkou po dobu 1 hodiny pri teplote miestnosti. Kontrastným bola vykonaná s DAPI za použitia imunofluorescencie kit (Beyotime). Bunky boli umiestnené a zobrazený pomocou laserového skenovania konfokálního mikroskopu.

Štatistická analýza

Dáta sú uvedené ako priemer ± SE z aspoň troch nezávislých experimentov. Štatistická analýza bola vykonaná s nepárový dvojstranného Studentov testu, pokiaľ nie je uvedené inak. P Hotel & lt; 0,05 bola považovaná za významnú.

Výsledky

SIRT3 expresiu v rakovinových bunkách žalúdku

SIRT3 je dobre definovaný v regulácii mitochondriálnej homeostázy v anti-aging a anti-transformácie. V poslednej dobe sa rôzne výsledky sú uvedené súvislosti s inhibíciou SIRT3 sprostredkovanú a proliferáciu buniek, čo vedie k diskusii o jeho úloha v nádorových ochorení [19,20]. Pre určenie potenciálnej úlohe SIRT3 v karcinómu žalúdka, expresia SIRT3 bola detekovaná v 4 bunkových línií karcinómu žalúdka AGS, SGC-7901, MGC-803, HGC-27 a skupina žalúdočných rakovinového nádoru tkaniva. Zistili sme, že hladina SIRT3 proteínov boli zvýšené vo všetkých 4 žalúdočných bunkových línií rakovinových v porovnaní s imortalizovaných žalúdočných epiteliálnych GES-1 buniek (AGS, 1,9-násobné, SGC-7901, 1,5-násobné, MGC-803, 2,0 násobku a HGC -27, 1,8-krát v porovnaní s GES-1 buniek) (obr 1A). V súlade hladiny mRNA SIRT3 v týchto bunkových líniách bola tiež zvýšená (AGS, 2,6-násobné, SGC-7901, 1,7-krát; MGC-803, 2,5-násobné, HGC-27, 2,2-krát) v porovnaní s GES- 1 buniek (obrázok 1B).

analýza Imunohistochémia v nádoru a v okolitom normálnom normálnych tkanív u skupiny pacientov s karcinómom žalúdka preukázali, že SIRT3-pozitívne bunky boli častejšie detegovateľný v nádorových tkanivách, ako je v normálnych tkanivách. Výsledky ukázali, že 55,1% z nádorového tkaniva (7% z normálnych tkanív), vykazovali vysokú úroveň (silný pozitívny), 41,4% nádorových tkanív (28% normálnych tkanív), vykazovali stredné vysokej úrovne (slabo pozitívna), pričom 3,5% z nádoru tkaniva a 64% z normálnych tkanív bol negatívny v SIRT3 výrazu (obr 1C a 1D, S1A obr). Je zaujímavé, že SIRT3 expresie črevného typu nádorového tkaniva (15 prípadov, 93,3% silne pozitívne a 6,6% slabo pozitívna) bolo významne vyššie než u difúzny typ nádorového tkaniva (14 prípadov, 14,3% silná pozitívna, 78,6% slabo pozitívna a 7.1 % negatívne) (obr 1C a 1E, S1B obr). Tieto výsledky naznačujú, že SIRT3 expresia je zvýšená u niektorých nádorov v porovnaní s príbuznými normálnych tkanív a SIRT3 expresie môže byť sa líši v jednotlivých nádorov, ktoré musia byť ďalej skúmaná.

úrovňou SIRT3 sú spojené s bunkovou proliferáciou
< p> Potom sme založili SIRT3 zvýšenú expresiu a porazený bunkových línií pomocou AGS a SGC-7901 bunky. Expresia SIRT3 v stabilných transfektantů bola potvrdená metódou Western blot. Nadmerná expresia SIRT3 zvyšuje rast buniek, zatiaľ čo SIRT3 porazený inhibujú rast buniek oboch bunkových línií karcinómu žalúdka (obr 2A). Ďalej, zvýšená expresia SIRT3 vyvolalo väčší tvorby kolónií ako kontrolné transfekované bunky, ktorá bola v rozpore s iba menší počet kolónií vytvorených v SIRT3 porazený buniek (obrázok 2B).

Pre ďalšie stanovenie role SIRT3 v schopnosti tvorby nádoru, sme injekčne SIRT3 zvýšenú expresiu a porazený SGC-7901 bunky do bokov holých myší a rast nádoru sa nechá počas 28 dní po inokulácii buniek (Obr S2). Priemerná hmotnosť nádorov odvodených od SIRT3 s nadmernou expresiou buniek bola 0,7079 g, podstatne väčšie, než je priemerná hmotnosť nádoru riadenia (NC), p
= 0,015, (obr 2C, ľavý panel). Na rozdiel od toho sa priemerná hmotnosť nádorov odvodených od SIRT3 porazený buniek bola 0,0588 g, podstatne menšie, než pri zakódovanie zhrnieme kontrolné bunky (SCR) (0,2033 g; p
= 0,009) (obr 2C, pravý panel) , Priemerný objem nádorov odvodených od SIRT3 s nadmernou expresiou buniek bola zvýšená než z kontrolných buniek (NC) (Obr 2C, ľavý panel hore pravého rohu). Naopak, priemerný objem nádorov rastúcich od SIRT3 porazený buniek bola významne menšie v porovnaní s kontrolnými bunkami z (SCR) (Obr 2C, pravý panel sa v pravom hornom rohu).

Enhanced glykolýze v SIRT3 exprimujúce rakoviny žalúdka bunky

boli sme potom zvedaví, ako mobilné bioenergetiky by mohla byť zmenená v rakovinových bunkách SIRT3-expresiou žalúdka. SIRT3 nadmerná expresia dramaticky zvýšila vychytávanie glukózy (1,4-násobne v AGS a 1,9-násobne v SGC-7901), zatiaľ čo SIRT3 porazený klesol príjem glukózy (okolo 40%, v oboch AGS a SGC-7901) (Obr 3A a 3B). V súlade s charakteristiky jej využitie glukózy, SIRT3 exprimujúce bunky mali zvýšené hladiny laktátu sekrécie (1,2-násobne v AGS, a 1,3-násobne v SGC-7901), vzhľadom k tomu, SIRT3 knockdown bunky mali znížené hladiny laktátu sekrécie (55% v AGS a 45 % v SGC-7901) (obr 3C a 3D). Tiež sme zistili, že tvorba glykogén bola významne zvýšená o SIRT3 nadmernej expresii (1,5-násobne v AGS a 1,3-násobne v SGC-7901), čo je funkcia rýchleho rastu nádorových buniek [33], zatiaľ čo zníži o SIRT3 smiešne nízke (40% v roku AGS a 70% v SGC-7901) (obr 3E a 3F).

SIRT3 bolo preukázané, ktoré sa podieľajú na metabolizme deacetyláciou globálnych enzýmov a udržiavanie bazálnej hladiny ATP v bunkách, a to ako v normálnom stave a pri chorobách [1 , 2]. Celková bunková ATP a glykolýza ATP generácie boli detekované v AGS, a SGC-7901 buniek s nadmernou expresiou buď SIRT3 alebo SIRT3 príklepu. Celkové bunkovej ATP hladiny boli zvýšené v SIRT3 s nadmernou expresiou buniek (asi 1,3-krát v oboch bunkových líniách), ale klesla SIRT3 porazený buniek (približne 75% v oboch bunkových líniách), v porovnaní s kontrolnými bunkami NC alebo SCR (obr 4A a 4B) , Potom sa spracuje buniek rotenón, že inhibujú oxidatívny fosforylácie, ATP a testované generáciu z glykolýzy. Ako je znázornené na obr 4C a 4D, SIRT3 nadmerná expresia vedie k zvýšeniu produkcie glykolýza ATP (1,4 násobne v AGS, a 1,6-násobne v SGC-7901), zatiaľ čo SIRT3 knockdown viedlo k výraznému poklesu výroby glykolýza ATP (20% v AGS a 40% v SGC-7901) v porovnaní s NC alebo SCR kontrolou.

SIRT3 reguluje homeostázy ROS v rakovinových bunkách žalúdku

a rad dôkazov podporuje, že zvýšená hladina ROS je kritický charakteristický znak v rakovinových bunkách, ktoré tvoria rakovinové bunky citlivejšie na ďalšie ROS stresu [34]. Tu sme zistili, že nadmerná expresia SIRT3 zníženej hladiny ROS na 70% a 80% v AGS a SGC-7901 buniek, zatiaľ čo inhibícia SIRT3 prejavu zvýšená hladina ROS (1,4-násobne v AGS buniek a 1,6-násobne v SGC-7901 buniek), respektíve (obr 5A a 5B). V zhode s literatúrou ukazuje SIRT3 deacetylates a aktivuje MnSOD (11, 12), do buniek karcinómu žalúdka, MnSOD aktivita bola zvýšená SIRT3 nadmernou expresiou (1,4 násobne v AGS bunkách a 1,2-násobne v SGC-7901 buniek), ale znižuje o SIRT3 knockdown (50% v AGS buniek a 65% v SGC-7901 buniek) (obr 5C a 5D), čo naznačuje, že SIRT3 môže chrániť bunky pred poškodením oxidačným stresom indukovanej vyváženie intracelulárnej ROS posilnením MnSOD aktivitu buniek karcinómu žalúdka.

SIRT3 deacetylates a aktivuje LDHA

LDHA hrá kľúčovú úlohu v iniciácii nádoru, údržbu a progresiu. Inhibícia LDHA blokuje aktivitu nádorového bujnenia, a progresiu nádorov [26,27] a LDHA aktivita môže byť regulovaná úpravou acetyláciou /deacetyláciou [35]. Boli sme zvedaví, či SIRT3 sa podieľa na regulácii LDHA činnosti. Zistili sme, že v nádorových bunkách žalúdka, LDHA aktivita bola významne zvýšená v SIRT3 nadmernou expresiou buniek, zatiaľ čo v SIRT3 porazený bunkách v porovnaní s NC alebo kontrolných buniek Scr oddelene bez detekovateľné zmeny úrovne LDHA proteínu v stabilných transfektantů (obr 6A) sa znížil. Imunologické výsledky ukázali, že LDHA a SIRT3 boli spoločne lokalizované v cytoplazme (obr 6B), a čo-IP analýza buď LDHA alebo SIRT3 protilátky, bolo zistené, že SIRT3 je schopný komunikovať s LDHA (obr 6C). Okrem toho je úroveň LDHA acetalizácie bola znížená v SIRT3 s nadmernou expresiou buniek, ale zvýšil v SIRT3 porazený bunkách (obr 6d). Ďalej, in vitro teste aktivity
LDHA vykonávať za použitia komerčné ľudský rekombinantný SIRT3 a hovädzieho srdce L-laktátdehydrogenáza je uvedené, že LDHA aktivita bola zvýšená prítomnosťou SIRT3 pri reakcii, ktorá sa zmenila pridaním inhibítora SIRT3 , nikotínamid (obrázok 6E). Identifikovať potenciálne miesto (y) SIRT3 deacetyláciou na LDHA, hľadali sme databázu a zistil, že K5, K14, K57, K81, K118, K126, K222 a K318 sú potenciálne acetalizácie miesta LDHA a predchádzajúce štúdie uvádza, že K5 acetalizácie /deacetyláciou bola podieľa na regulácii LDHA aktivity [35]. Potom sme urobili LDHA aktivity analýzu s použitím lyzín 5 a lyzín 318 acetylácii Mimic (K5Q /K318Q) alebo deacetyláciou napodobňovať (K5R /K318R) mutant LDHA, a zistil, že ani K5, ani K318 bol vyžadovaný pre SIRT3 sprostredkované LDHA aktiváciou (S3 Obr). Ďalšia identifikácia SIRT3 sprostredkované LDHA deacetyláciou je v núdzi.

SIRT3 upregulates gény zapojené do bunkového metabolizmu

Ak chcete charakterizovať molekulárnej podpis SIRT3-LDHA sprostredkovaných bioenergetiky v nádorových bunkách žalúdka, Merali sme expresie génov spojených s dopravou a glukózy glykolýze. Dáta na obrázku 7A a 7B ukazujú, že nadmerná expresia SIRT3 v AGS alebo SGC-7901 indukovanej expresiu VO2 (1,47 násobne v AGS bunkách, 1,3-násobne v SGC-7901 buniek), MCT4 (2,3-násobne v AGS bunkách, 1.34 násobne v SGC-7901 buniek) a Glut1 (1,55-násobné v AGS bunkách, 1,38-násobné v SGC-7901 buniek) na úrovni mRNA testovaného real-time PCR. Naopak, SIRT3 knockdown znížil expresiu génu VO2 na 76%, MCT4 do 73% a Glut1 na 62% v AGS bunkách, zatiaľ čo VO2 na 80%, MCT4 na 62% a Glut1 na 74% v SGC-7901 bunky. Okrem toho, keď bola SIRT3 nadmerne exprimované, úroveň MCT1 mRNA bola v AGS bunkách zvýšila o 1,6 násobne, ale nie v SGC-7901 buniek, a keď SIRT3 porazený, MCT1 bol v SGC-7901 buniek sa znížil na 59%, v AGS, a 65% , v danom poradí.

Diskusia

Táto štúdia poskytuje dôkazy o tom, že SIRT3 exprimovaný v niektorých nádorových buniek, ako sú rakovinové bunky žalúdka, môže byť spojená so zvýšenou agresivitou od bioenergia SIRT3 sprostredkovanú cez deacetyláciou a aktivácia ladhu. Aj keď hromadí dôkazy naznačujú, že SIRT3 hrá kľúčovú úlohu pri ochrane normálnych buniek proti starnutiu a malígne transformácie, jej funkcie v už transformovaných bunkách, ako sú nádorové bunky, ktoré exprimujú SIRT3 musí byť skúmaná [19]. Nedostatok SIRT3 v MEF vedie k nestabilite genómu a vysokou frekvenciou bunkovej transformácie sprostredkovanej Ras so zvýšenou mierou tvorby nádorov a starnutie, čo naznačuje, že SIRT3 je nutná prevencia bunkového starnutia a karcinogenézy [11,15]. Okrem toho nedostatok alebo nižšia expresie SIRT3 je detekovaná v rôznych ľudských nádorov a úroveň SIRT3 je spojený s citlivosťou nádorových buniek k chemoterapii a rádioterapii [11,15,16]. Avšak, je tiež uvedená SIRT3 byť nadmerne exprimovaný v ľudských nádorov a spojené s rezistenciou terapie [19,21,36]. Tieto výsledky naznačujú, že SIRT3 môžu byť zamerané na rôzne proteíny medzi normálnou a nádorové bunky, a to SIRT3 expresie sa môže meniť v rôznych typov rakoviny, ako je napríklad aktuálne výsledky uvádzajú, že črevná typ rakoviny žalúdka vyjadruje vyššiu úroveň SIRT3 ako difúzny druh rakoviny žalúdka.

bolo všeobecne známe, že nádorové bunky bunkovej spotrebovávať viac energie na podporu rýchleho rastu a proliferácie ako normálne bunky pomocou glykolýzy, ako hlavný zdroj ATP generácia namiesto oxidatívny fosforylácie [24] , V súčasnej štúdii sme ukázali, že v nádorových bunkách žalúdka, SIRT3 interaguje s a deacetylates LDHA, čo spôsobuje zvýšenú aktivitu LDHA; a SIRT3 nadmerná expresia vedie k zvýšeniu produkcie ATP a MnSOD činnosť paralelne s obmedzenou bunkovej úrovni ROS, čo naznačuje zvýšenú oxidačné vychytávacie schopnosti SIRT3 prípadne prostredníctvom aktivácie deacetyláciou sprostredkované MnSOD enzýmu. Pribúda dôkazov ukazuje, že SIRT3 je nutná pre udržanie bunkovej a mitochondriálnej homeostázy skrze reguláciu mitochondriálneho metabolizmu a vyváženie systému bunkovej redoxné, ktoré chránia bunky pred oxidačným stresom cez regulačný ROS generácie, kritický mechanizmus starnutia, rakoviny a srdcových chorôb [1,2, 37]. SIRT3 môže deacetylate skupinu mitochondrií cieľov podieľa na regulácii ako glykolýzy a bunkovej oxidačný stres. V poslednej dobe sa zistí SIRT3 moci deacetylate a zvýšenie pyruvát dehydrogenázy aktivitu v nádorových bunkách, čo môže zvýšiť ako mitochondriálnej bioenergetický a glykolýzy [38]. V dohode, aktuálne štúdia ukazuje, že môžu SIRT3 deacetylate a aktivovať LDHA ktorý môže byť použitý ako pre mitochondriálnej dýchanie a glykolýzu. Na druhej strane, môže SIRT3 deacetylate a následne aktivácii iných mitochondrií substráty, ako je napríklad MnSOD [11,12], [39] Foxo3 a IDH2 [9] zachytávať ROS produkované oxidačná fosforylácia, chráni bunky pred oxidačným poškodením [40] , Tiež v súlade s týmito zisteniami, v tejto štúdii sme zistili, že nadmerná expresia sa zvyšuje SIRT3 MnSOD aktivitu, ktorá môže byť jedným z dôvodov zníženej bunkovej úrovni ROS za zvýšenej bunkovej stavu metabolizmu.

LDHA, ako člen rodiny laktátu (LDH), sa nachádza existoval v glykolytických bunkách a lokalizované v mitochondriách okrem cytosolu [41], najmä katalyzujúcou vzájomnú premenu pyruvátu a laktátu [42]. LDHA je preukázané, že hrajú kľúčovú úlohu v aeróbnej glykolýzy a tumorigenicity u malígnych buniek [26,27]. V rakovinových bunkách, LDHA rýchlo spotrebuje pyruvátu produkoval glykolýzy, čo vedie k zvýšeniu aeróbnej produkcie laktátu [26]. Inhibícia LDHA indukuje produkciu ROS, znižuje bunkovej hladiny ATP a inhibuje glykolýzu, teda inhibuje rast buniek a vyvoláva bunkovú smrť u rakoviny [27]. Skladá sa s týmito správami, sme zistili, že SIRT3 môže interagovať a aktivovať LDHA. V SIRT3 exprimujúcich buniek, LDHA acetalizácie sa znížila so zvýšenou enzýmovou aktivitou LDHA. Hoci presný mechanizmus spôsobujúci reguláciu LDHA SIRT3 sprostredkované musí byť ďalej skúmaná, tieto výsledky ukazujú, že LDHA riadené glykolýzy cestu, ktorá urýchľuje nádorové bioenergetický môže byť ovplyvnená úrovňou SIRT3 expresie.

Naša súčasná štúdia tiež ukázala, že expresia skupina génov, ako je napríklad MCT1, MCT4, VO2 a Glut1, známy ako kľúčové regulátory energetického metabolizmu pri karcinóme sa zvýšili aj v nádorových bunkách SIRT3-nadmernou expresiou žalúdka, čo ukazuje na potenciálnu úlohu pri posilňovaní SIRT3 glykolýzy v nádorových bunkách. HK2 katalyzuje fosforylácii glukózy na glukóza-6-fosfátu v počiatočnom kroku glykolýzy [43]. Glukózy transporter (GLUT) riadi transport glukózy cez plazmatickú membránu, fungujúci ako prvý krok limitujúcim rýchlosť metabolizmu glukózy [44]. MCT1 a MCT4, členovia monocarboxylates (napríklad laktátu a pyruvátu) transportéra rodiny, sa tiež podieľajú na raste glykolýzy závislých nádorov [45]. Spoločne tieto výsledky naznačujú potenciálne súhru SIRT3 a skupiny glykolýzy asociovaných génov v signálnych nádoru agresívny rast, ktorý je potrebné ďalej vyšetrovať.

Na záver, aj keď SIRT3 je dobre charakterizovaná v mitochondriálnej homeostázy proti bunke starnutia a transformácie, expresia SIRT3 v nádorových bunkách je spojená so zvýšenou proliferáciu a agresívny rast buniek karcinómu žalúdka. SIRT3 k vzájomnému pôsobeniu a aktivuje LDHA, čo vedie k zvýšenej glykolýzy a produkcie ATP, ktorý spolu so zvýšenou mitochondriálnej antioxidačné MnSOD činnosti a k ​​zníženiu intracelulárnej hladinu ROS (hypotetickej model je navrhnuté na obr 7C). To znamená, že funkcia rast stimulujúce z SIRT3 demonštruje potenciálny cieľ pre liečbu nádorov s SIRT3 výrazom.

Podporné informácie
S1 Obr. Reprezentatívny patologické šmýkačky pre stanovenie expresie SIRT3 v ľudských vzorkách s karcinómom žalúdka.
, Parafín zaliate ľudské rakoviny žalúdka a spárovaný susedné vzorky patologicky normálneho tkaniva boli podrobené imunohistochemického farbenia s protilátkou SIRT3 (hnedá), nasleduje jadra kontrastným farbivom hematoxylínom ( blue, každý nádor bol zobrazený s priľahlými normálnych tkanív v jednom rade od 20 x a 40 x). B, reprezentatívne obrazy SIRT3 expresie v črevnom a difúznych typov rakoviny žalúdka. Mierka, 50 um
doi :. 10,1371 /journal.pone.0129834.s001
(TIF)
S2 Obr. Nadmerná expresia SIRT3 podporovaná tumoru in vivo.
SGC-7901 buniek s nadmernou expresiou SIRT3 (A) alebo Knockdown (B) boli subkutánne injikované do pravého boku nahých myší s relatívnymi kontrolné bunky (NC alebo SCR) do ľavej bok. Xenografe nádory boli vybraté a zvážené na 28. deň po inokulácii buniek. Obrazy pravom paneli ukázali xenografe nádorov in vivo na konci experimentu. Snímky ukázali rast nádoru u myší
doi :. 10,1371 /journal.pone.0129834.s002
(TIF)
S3 Obr.

Other Languages